메뉴 건너뛰기

[29] DNA to RNA

jhan 2017.01.15 21:20 조회 수 : 9

다음 DNA 서열을 RNA 로 변환해 봅시다

 

ACCTGAATGACCAAGATTTA

위로