메뉴 건너뛰기

[31] 상보적 DNA 서열 구하기

jhan 2017.01.15 21:21 조회 수 : 10

다음 주어진 서열의 상보적 DNA 서열을 구하는 스크립트를 작성해보세요

 

ACTTACGGCATTAGACATTA

위로