메뉴 건너뛰기

다음 주어진 FASTA 파일에서 "GGGCGGGC" 서열의 출현 회수를 구하는 스크립트를 작성해보세요


https://raw.githubusercontent.com/KennethJHan/Bioinformatics_smalltalk_Python50/master/Q32.fa

> SeqID_1
ATGCAGTACCGGAGGGCGGGCTTAT
TAAGAGGAACCAGATTACCAGGGCG
GGCGGGCAACTAAGGCACGGTAAAG
CCCAAGGATAAGACGGGCGGGCAAA

 

 

 

위로