메뉴 건너뛰기

[37] FASTQ to FASTA

jhan 2017.01.15 21:29 조회 수 : 11

FASTQ 포맷을 FASTA 포맷으로 변환하는 스크립트를 작성해 봅시다

 

 

다음은 샘플 FASTQ 입니다

 

@SEQ_ID

GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT

+

!’'*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

위로